catcheR_10Xnocatch - Identify cells expressing no shRNA ======================================================== This optional step identifies and annotates cells transduced with a cassette lacking the shRNA. These "empty" cells can be included as negative controls in downstream analyses. In the same working directory used for :func:`catcheR_10Xcatch`, run: .. code-block:: R catcheR_10Xnocatch( group = c("docker", "sudo"), folder, expression.matrix, threshold, sample = 1, reference = "TACGCGTTCATCTGGGGGAGCCG" ) **Arguments**: - ``group``: either `"docker"` or `"sudo"`, depending on user permissions (see: https://docs.docker.com/engine/install/linux-postinstall/) - ``folder``: path to the working directory - ``expression.matrix``: filename of the cell-by-gene count matrix (CSV format) - ``threshold``: *integer* number of UMIs supporting the "empty" reference required to classify a cell as empty - ``sample``: *integer* sample index (default = 1) - ``reference``: string of the reverse complement of the empty vector’s unique identifier (default is the 3' end of the OPTtetR cDNA) **Example usage**: .. code-block:: R catcheR_10Xnocatch( group = "docker", folder = "path/to/folder", expression.matrix = "filename.csv", threshold = 5 ) **Output**: - An updated ``silencing_matrix.csv`` (also in RDS format), where empty cells are annotated using the following format: .. code-block:: text cellID_?_empty_NA_empty This enables easy tracking of negative control cells for further analysis.