catcheR_design - Oligonucleotide Design ====================== This step complements Supplemental Protocol 1. 1. In a new working folder, prepare the following files: a. A comma-separated values (CSV) file with three columns listing: (1) the forward oligos from the TRC shRNA library (2) the corresponding barcodes (BC) (3) the shRNA names Below is an example for the shRNA described in :ref:`FigureSPOneOne`: .. code-block:: text CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG,CAGTTCCA,SMAD2.1 ... b. *(Optional)* A `.txt` file with a newline-separated list of 5'-3' restriction sites, or other sequences to be avoided in the shRNAs. By default these are SalI, SwaI, and AscI: .. code-block:: text GTCGAC ATTTAAAT GGCGCGCC 2. Run ``catcheR_design``: .. code-block:: R catcheR_design( group = c("docker", "sudo"), folder, sequences, gibson.five = "AGTTCCCTATCAGTGATAGAGATCCC", gibson.three = "GTAGCTCGCTGATCAGC", fixed = "GTCGACATTTAAATGGCGCGCC", restriction.sites = NULL ) **`catcheR_design` arguments:** a. ``group``: string, one of `"docker"` or `"sudo"` depending on user permissions *(For a detailed explanation of Docker user groups, see:* https://docs.docker.com/engine/install/linux-postinstall/ *) b. ``folder``: string with the path to the working folder c. ``sequences``: string with the CSV file name from step 1a d. ``gibson.five``: *(optional)* string with the 5' Gibson homology sequence e. ``gibson.three``: *(optional)* string with the 3' Gibson homology sequence f. ``fixed``: *(optional)* string with the multicloning site g. ``restriction.sites``: *(optional)* string with the `.txt` file name from step 1b **Example usage:** .. code-block:: R catcheR_design( group = "docker", folder = "path/to/folder", sequences = "filename.csv", restriction.sites = "filename.txt" ) **`catcheR_design` outputs:** a. ``output.txt`` – contains the oligo sequences to be used for synthesis (see :ref:`FigureSPOneOne`) b. ``bad_oligos.txt`` – lists the shRNAs containing forbidden restriction sites (highlighted in lowercase characters). This can be used to refine the shRNA list. Example output from ``bad_oligos.txt``: .. code-block:: text AGTTCCCTATCAGTGATAGAGATCCCGGACATAATCACTGCGTAATCCTCagatctTACGCAGTGATTATGTCCTTTTTTTGT- CGACATTTAAATGGCGCGCCNNNNNNGCTGAAGAGTAGCTCGCTGATCAGC,GATA4 ...