catcheR_scinocatch - Identify cells expressing no shRNA in iPS2-sci-seq
============================================================================

Run :func:`catcheR_scinocatch` following the steps described for :func:`catcheR_10Xnocatch` in :ref:`par-SPFourParFour`.  
   This function shares the same arguments and outputs but is used for sci-seq data, operating on the output of :func:`catcheR_scicatch`.

.. code-block:: R

    catcheR_scinocatch(
        group = "docker", 
        folder = "path/to/working/folder", 
        expression.matrix = "filename.csv",
        threshold = 5,
        reference = "TACGCGTTCATCTGGGGGAG")

..
    Arguments:
        - group: either "docker" or "sudo"
        - folder: path to the working directory used for :func:`catcheR_scicatch`
        - expression.matrix: CSV file generated by :func:`catcheR_scicount`
        - threshold: minimum number of UMIs mapping to the empty cassette (default 5)
        - reference: reverse complement of the sequence preceding the UCI (default matches empty cassette in iPS2 constructs)

..
    Output:
        An updated ``silencing_matrix.csv`` (and corresponding RDS) with cells identified as lacking shRNA, 
        annotated as:

.. code-block:: text

    cellID_?_empty_NA_empty