catcheR_design - Oligonucleotide Design¶
This step complements Supplemental Protocol 1.
In a new working folder, prepare the following files:
A comma-separated values (CSV) file with three columns listing: (1) the forward oligos from the TRC shRNA library (2) the corresponding barcodes (BC) (3) the shRNA names
Below is an example for the shRNA described in FigureSPOneOne:
CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG,CAGTTCCA,SMAD2.1 ...
(Optional) A .txt file with a newline-separated list of 5’-3’ restriction sites, or other sequences to be avoided in the shRNAs. By default these are SalI, SwaI, and AscI:
GTCGAC ATTTAAAT GGCGCGCC
Run
catcheR_design:catcheR_design( group = c("docker", "sudo"), folder, sequences, gibson.five = "AGTTCCCTATCAGTGATAGAGATCCC", gibson.three = "GTAGCTCGCTGATCAGC", fixed = "GTCGACATTTAAATGGCGCGCC", restriction.sites = NULL )
`catcheR_design` arguments:
group: string, one of “docker” or “sudo” depending on user permissions (For a detailed explanation of Docker user groups, see: https://docs.docker.com/engine/install/linux-postinstall/ *)folder: string with the path to the working foldersequences: string with the CSV file name from step 1agibson.five: (optional) string with the 5’ Gibson homology sequencegibson.three: (optional) string with the 3’ Gibson homology sequencefixed: (optional) string with the multicloning siterestriction.sites: (optional) string with the .txt file name from step 1b
Example usage:
catcheR_design( group = "docker", folder = "path/to/folder", sequences = "filename.csv", restriction.sites = "filename.txt" )
`catcheR_design` outputs:
output.txt– contains the oligo sequences to be used for synthesis (see FigureSPOneOne)bad_oligos.txt– lists the shRNAs containing forbidden restriction sites (highlighted in lowercase characters). This can be used to refine the shRNA list.
Example output from
bad_oligos.txt:AGTTCCCTATCAGTGATAGAGATCCCGGACATAATCACTGCGTAATCCTCagatctTACGCAGTGATTATGTCCTTTTTTTGT- CGACATTTAAATGGCGCGCCNNNNNNGCTGAAGAGTAGCTCGCTGATCAGC,GATA4 ...